tondevrel

biopython

Comprehensive guide for Biopython - the premier Python library for computational biology and bioinformatics. Use for DNA/RNA/protein sequence analysis, file I/O (FASTA, FASTQ, GenBank, PDB), sequence alignment, BLAST searches, phylogenetic analysis, structure analysis, and NCBI database access.

tondevrel 9 1 Updated 4mo ago
GitHub

Install

npx skillscat add tondevrel/scientific-agent-skills/biopython

Install via the SkillsCat registry.

SKILL.md

Biopython - Bioinformatics Library

Industry-standard Python library for computational biology and bioinformatics workflows.

When to Use

  • Parsing and manipulating biological sequences (DNA, RNA, protein)
  • Reading and writing sequence files (FASTA, FASTQ, GenBank, EMBL, SwissProt)
  • Performing sequence alignments (pairwise and multiple)
  • Running and parsing BLAST searches
  • Analyzing protein structures from PDB files
  • Calculating sequence statistics and molecular weights
  • Translating DNA to protein sequences
  • Finding restriction enzyme sites
  • Building and analyzing phylogenetic trees
  • Accessing NCBI databases (Entrez, PubMed)
  • Computing sequence motifs and patterns
  • Analyzing next-generation sequencing data

Reference Documentation

Official docs: https://biopython.org/
Tutorial: https://biopython.org/DIST/docs/tutorial/Tutorial.html
Search patterns: SeqIO.parse, Seq, AlignIO, NCBIWWW.qblast, PDBParser

Core Principles

Use Biopython For

Task Module Example
Create sequences Seq Seq("ATCG")
Read sequence files SeqIO SeqIO.parse("file.fasta", "fasta")
Pairwise alignment pairwise2 pairwise2.align.globalxx(s1, s2)
Multiple alignment AlignIO AlignIO.read("align.fasta", "fasta")
BLAST searches NCBIWWW NCBIWWW.qblast("blastn", "nr", seq)
PDB structures PDB.PDBParser PDBParser().get_structure()
Phylogenetic trees Phylo Phylo.read("tree.xml", "phyloxml")
NCBI databases Entrez Entrez.esearch(db="nucleotide")

Do NOT Use For

  • High-performance genome assembly (use SPAdes, Canu)
  • Variant calling from BAM files (use GATK, BCFtools)
  • RNA-seq differential expression (use DESeq2, edgeR)
  • Protein structure prediction (use AlphaFold, RoseTTAFold)
  • Large-scale metagenomics (use specialized pipelines)

Quick Reference

Installation

# pip (recommended)
pip install biopython

# With optional dependencies
pip install biopython[extra]

# conda
conda install -c conda-forge biopython

# Development version
pip install git+https://github.com/biopython/biopython.git

Standard Imports

# Core sequence handling
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio import SeqIO, AlignIO

# Sequence alignment
from Bio import pairwise2
from Bio.Align import MultipleSeqAlignment
from Bio.Align.Applications import ClustalwCommandline

# BLAST
from Bio.Blast import NCBIWWW, NCBIXML

# Structure analysis
from Bio.PDB import PDBParser, PDBIO, Select
from Bio.PDB.DSSP import DSSP
from Bio.PDB.Polypeptide import PPBuilder

# Phylogenetics
from Bio import Phylo
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor

# NCBI Entrez
from Bio import Entrez

# Additional tools
from Bio.SeqUtils import GC, molecular_weight
from Bio.Restriction import *

Basic Pattern - Sequence Creation

from Bio.Seq import Seq

# Create DNA sequence
dna = Seq("ATGGCCATTGTAATGGGCCGC")

# Transcribe to RNA
rna = dna.transcribe()

# Translate to protein
protein = dna.translate()

# Reverse complement
rev_comp = dna.reverse_complement()

print(f"DNA:     {dna}")
print(f"RNA:     {rna}")
print(f"Protein: {protein}")
print(f"RevComp: {rev_comp}")

Basic Pattern - File Reading

from Bio import SeqIO

# Read FASTA file (iterator - memory efficient)
for record in SeqIO.parse("sequences.fasta", "fasta"):
    print(f"ID: {record.id}")
    print(f"Length: {len(record.seq)}")
    print(f"Sequence: {record.seq[:50]}...")

# Read single sequence
record = SeqIO.read("single.fasta", "fasta")

Basic Pattern - Sequence Alignment

from Bio import pairwise2
from Bio.Seq import Seq

seq1 = Seq("ACCGT")
seq2 = Seq("ACGT")

# Global alignment
alignments = pairwise2.align.globalxx(seq1, seq2)

# Print best alignment
best = alignments[0]
print(pairwise2.format_alignment(*best))

Critical Rules

✅ DO

  • Use iterators for large files - SeqIO.parse() not SeqIO.to_dict()
  • Validate sequences - Check alphabet and length before operations
  • Handle file formats correctly - Match parser to actual file format
  • Check alignment quality - Verify gaps and identity percentages
  • Use appropriate genetic code - Specify table for translation
  • Close file handles - Use context managers or explicit close
  • Filter FASTQ by quality - Don't trust all reads equally
  • Verify PDB structure - Check for missing atoms/residues
  • Set Entrez email - Required for NCBI API usage
  • Handle translation frames - Consider all three reading frames

❌ DON'T

  • Load entire FASTQ into memory - Use streaming
  • Ignore sequence type - DNA, RNA, and protein need different handling
  • Skip quality filtering - FASTQ quality scores matter
  • Use wrong genetic code - Different organisms use different tables
  • Forget stop codons - Handle them explicitly in translation
  • Mix alphabets - Don't compare DNA with protein sequences
  • Trust all BLAST hits - Filter by e-value and identity
  • Ignore chain breaks - PDB structures may have gaps
  • Hammer NCBI servers - Use rate limiting (3 requests/sec without API key)
  • Compare raw sequences - Align first, then compare

Anti-Patterns (NEVER)

# ❌ BAD: Loading entire file into memory
records = list(SeqIO.parse("huge.fastq", "fastq"))
for record in records:
    process(record)  # OOM for large files!

# ✅ GOOD: Stream processing
for record in SeqIO.parse("huge.fastq", "fastq"):
    if min(record.letter_annotations["phred_quality"]) >= 20:
        process(record)

# ❌ BAD: Translating without checking frame
protein = dna_seq.translate()
# May include stop codons or wrong frame!

# ✅ GOOD: Specify frame and stop codon handling
protein = dna_seq.translate(to_stop=True, table=1)

# ❌ BAD: No email for Entrez
Entrez.esearch(db="nucleotide", term="human")
# NCBI will block you!

# ✅ GOOD: Always set email
Entrez.email = "your.email@example.com"
handle = Entrez.esearch(db="nucleotide", term="human")

# ❌ BAD: Comparing sequences directly
if str(seq1) == str(seq2):
    print("Same")  # Ignores gaps, misalignments!

# ✅ GOOD: Align then compare
from Bio import pairwise2
alignments = pairwise2.align.globalxx(seq1, seq2)
score = alignments[0][2]  # Alignment score

# ❌ BAD: Wrong file format
records = SeqIO.parse("file.gb", "fasta")  # Wrong!

# ✅ GOOD: Match format to file
records = SeqIO.parse("file.gb", "genbank")

Sequence Objects

Creating and Manipulating Sequences

from Bio.Seq import Seq
from Bio.Alphabet import IUPAC

# DNA sequence
dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")

# Basic operations
length = len(dna)
gc_count = dna.count("G") + dna.count("C")
gc_content = (gc_count / length) * 100

# Find subsequence
position = dna.find("ATG")  # Returns index or -1

# Slicing
first_codon = dna[:3]
last_10 = dna[-10:]

print(f"Length: {length}")
print(f"GC content: {gc_content:.2f}%")
print(f"ATG at position: {position}")

Transcription and Translation

from Bio.Seq import Seq

# DNA to RNA transcription
dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
rna = dna.transcribe()

# RNA to protein translation
protein = rna.translate()

# DNA to protein (direct)
protein_direct = dna.translate()

# Back-transcription
dna_back = rna.back_transcribe()

# Reverse complement
rev_comp = dna.reverse_complement()

print(f"DNA:        {dna}")
print(f"RNA:        {rna}")
print(f"Protein:    {protein}")
print(f"Rev Comp:   {rev_comp}")

Translation with Different Genetic Codes

from Bio.Seq import Seq

dna = Seq("ATGGGCTAG")

# Standard genetic code (table 1)
protein_standard = dna.translate(table=1)

# Mitochondrial genetic code (table 2)
protein_mito = dna.translate(table=2)

# Stop at first stop codon
protein_to_stop = dna.translate(to_stop=True)

# All three reading frames
for i in range(3):
    frame = dna[i:]
    protein = frame.translate(to_stop=True)
    print(f"Frame {i}: {protein}")

Sequence Utilities

from Bio.Seq import Seq
from Bio.SeqUtils import GC, molecular_weight

seq = Seq("ATGGCCATTGTAATGGGCCGC")

# GC content
gc = GC(seq)

# Molecular weight
mw = molecular_weight(seq, seq_type='DNA')

# GC skew (for origin of replication analysis)
from Bio.SeqUtils import GC_skew
skew = GC_skew(seq, window=100)

print(f"GC content: {gc:.2f}%")
print(f"Molecular weight: {mw:.2f} Da")

SeqRecord Objects

Creating SeqRecord Objects

from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord

# Create with minimal info
seq = Seq("ATGGCCATTG")
record = SeqRecord(seq, id="seq1", description="My sequence")

# With full annotation
record = SeqRecord(
    Seq("ATGGCCATTG"),
    id="gene1",
    name="GeneName",
    description="Gene encoding protein X",
    annotations={
        "organism": "Homo sapiens",
        "molecule_type": "DNA"
    }
)

# Add features
from Bio.SeqFeature import SeqFeature, FeatureLocation
feature = SeqFeature(
    FeatureLocation(0, 10),
    type="CDS",
    qualifiers={"product": "hypothetical protein"}
)
record.features.append(feature)

print(record)

SeqRecord Attributes

from Bio import SeqIO

record = SeqIO.read("sequence.gb", "genbank")

# Access components
sequence = record.seq
identifier = record.id
name = record.name
description = record.description

# Annotations (dictionary)
organism = record.annotations.get("organism", "Unknown")

# Features (list)
for feature in record.features:
    if feature.type == "CDS":
        product = feature.qualifiers.get("product", ["Unknown"])[0]
        location = feature.location
        print(f"{product} at {location}")

# Letter annotations (quality scores for FASTQ)
if "phred_quality" in record.letter_annotations:
    avg_quality = sum(record.letter_annotations["phred_quality"]) / len(record)
    print(f"Average quality: {avg_quality:.2f}")

File Input/Output

Reading FASTA Files

from Bio import SeqIO

# Single sequence
record = SeqIO.read("single.fasta", "fasta")
print(f"{record.id}: {record.seq}")

# Multiple sequences (iterator)
for record in SeqIO.parse("multiple.fasta", "fasta"):
    print(f"{record.id}: {len(record.seq)} bp")

# Load into dictionary (use sparingly!)
sequences = SeqIO.to_dict(SeqIO.parse("sequences.fasta", "fasta"))
seq1 = sequences["seq1"]

Writing FASTA Files

from Bio import SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord

# Create records
records = []
for i in range(10):
    seq = Seq("ATCG" * (i + 1))
    record = SeqRecord(seq, id=f"seq_{i}", description=f"Sequence {i}")
    records.append(record)

# Write to file
SeqIO.write(records, "output.fasta", "fasta")

# Append to existing file
with open("output.fasta", "a") as f:
    SeqIO.write(record, f, "fasta")

Reading FASTQ Files

from Bio import SeqIO

# Read FASTQ with quality scores
for record in SeqIO.parse("reads.fastq", "fastq"):
    seq_id = record.id
    sequence = record.seq
    quality = record.letter_annotations["phred_quality"]
    
    avg_q = sum(quality) / len(quality)
    min_q = min(quality)
    
    print(f"{seq_id}: avg Q={avg_q:.1f}, min Q={min_q}")

Quality Filtering FASTQ

from Bio import SeqIO

def filter_fastq(input_file, output_file, min_quality=20, min_length=50):
    """Filter FASTQ by quality and length."""
    good_reads = 0
    
    with open(output_file, "w") as out_handle:
        for record in SeqIO.parse(input_file, "fastq"):
            # Check length
            if len(record.seq) < min_length:
                continue
            
            # Check quality
            qualities = record.letter_annotations["phred_quality"]
            if min(qualities) >= min_quality:
                SeqIO.write(record, out_handle, "fastq")
                good_reads += 1
    
    return good_reads

# Filter reads
n_passed = filter_fastq("raw.fastq", "filtered.fastq")
print(f"Passed: {n_passed} reads")

Reading GenBank Files

from Bio import SeqIO

# GenBank files have rich annotations
for record in SeqIO.parse("sequence.gb", "genbank"):
    print(f"ID: {record.id}")
    print(f"Organism: {record.annotations['organism']}")
    print(f"Sequence length: {len(record.seq)}")
    
    # Extract features
    for feature in record.features:
        if feature.type == "CDS":
            product = feature.qualifiers.get("product", ["Unknown"])[0]
            start = feature.location.start
            end = feature.location.end
            print(f"  CDS: {product} ({start}-{end})")

Converting File Formats

from Bio import SeqIO

# Convert GenBank to FASTA
records = SeqIO.parse("input.gb", "genbank")
SeqIO.write(records, "output.fasta", "fasta")

# Convert FASTQ to FASTA (lose quality scores)
records = SeqIO.parse("reads.fastq", "fastq")
SeqIO.write(records, "sequences.fasta", "fasta")

# Multiple format conversions in one go
def convert_format(input_file, input_format, output_file, output_format):
    """Generic format converter."""
    count = SeqIO.convert(input_file, input_format, output_file, output_format)
    print(f"Converted {count} records")

convert_format("seq.gb", "genbank", "seq.fasta", "fasta")

Sequence Alignment

Pairwise Alignment

from Bio import pairwise2
from Bio.Seq import Seq
from Bio.pairwise2 import format_alignment

seq1 = Seq("ACCGGT")
seq2 = Seq("ACGT")

# Global alignment (Needleman-Wunsch)
alignments = pairwise2.align.globalxx(seq1, seq2)

# Print best alignment
best = alignments[0]
print(format_alignment(*best))

# With scoring matrix
alignments = pairwise2.align.globalms(
    seq1, seq2,
    match=2,      # Match score
    mismatch=-1,  # Mismatch penalty
    open=-0.5,    # Gap open penalty
    extend=-0.1   # Gap extension penalty
)

Custom Scoring

from Bio import pairwise2
from Bio.Seq import Seq
from Bio.Align import substitution_matrices

seq1 = Seq("KEVLA")
seq2 = Seq("KELVA")

# Use BLOSUM62 matrix
matrix = substitution_matrices.load("BLOSUM62")

alignments = pairwise2.align.globaldx(
    seq1, seq2,
    matrix,
    open=-10,
    extend=-0.5
)

print(pairwise2.format_alignment(*alignments[0]))

Local Alignment

from Bio import pairwise2
from Bio.Seq import Seq

# Local alignment (Smith-Waterman)
seq1 = Seq("GCATGCTAGATGCTA")
seq2 = Seq("ATGCTA")

alignments = pairwise2.align.localxx(seq1, seq2)

# Best local alignment
best = alignments[0]
print(pairwise2.format_alignment(*best))

Multiple Sequence Alignment

from Bio import AlignIO
from Bio.Align.Applications import ClustalwCommandline

# Run ClustalW (requires installation)
cline = ClustalwCommandline("clustalw2", infile="sequences.fasta")
stdout, stderr = cline()

# Read alignment
alignment = AlignIO.read("sequences.aln", "clustal")

print(f"Alignment length: {alignment.get_alignment_length()}")
print(f"Number of sequences: {len(alignment)}")

# Print alignment
print(alignment)

# Access sequences
for record in alignment:
    print(f"{record.id}: {record.seq}")

Alignment Statistics

from Bio import AlignIO

alignment = AlignIO.read("alignment.fasta", "fasta")

# Calculate identity
def calculate_identity(alignment):
    """Calculate pairwise identity matrix."""
    n = len(alignment)
    identities = []
    
    for i in range(n):
        for j in range(i+1, n):
            seq1 = alignment[i].seq
            seq2 = alignment[j].seq
            
            matches = sum(a == b for a, b in zip(seq1, seq2) if a != '-' and b != '-')
            aligned_length = sum(1 for a, b in zip(seq1, seq2) if a != '-' and b != '-')
            
            identity = matches / aligned_length * 100 if aligned_length > 0 else 0
            identities.append(identity)
    
    return identities

identities = calculate_identity(alignment)
print(f"Average identity: {sum(identities)/len(identities):.2f}%")

BLAST Searches

Running BLAST Online

from Bio.Blast import NCBIWWW, NCBIXML
from Bio import SeqIO

# Read query sequence
record = SeqIO.read("query.fasta", "fasta")

# Run BLAST
result_handle = NCBIWWW.qblast(
    program="blastn",     # blastn, blastp, blastx, tblastn, tblastx
    database="nt",        # nt, nr, refseq_rna, etc.
    sequence=str(record.seq),
    hitlist_size=10
)

# Save results
with open("blast_results.xml", "w") as out_handle:
    out_handle.write(result_handle.read())

result_handle.close()

Parsing BLAST Results

from Bio.Blast import NCBIXML

# Parse BLAST XML output
with open("blast_results.xml") as result_handle:
    blast_records = NCBIXML.parse(result_handle)
    
    for blast_record in blast_records:
        print(f"Query: {blast_record.query}")
        print(f"Number of hits: {len(blast_record.alignments)}")
        
        for alignment in blast_record.alignments:
            for hsp in alignment.hsps:
                if hsp.expect < 0.001:  # E-value threshold
                    print(f"\n  Hit: {alignment.title}")
                    print(f"  Length: {alignment.length}")
                    print(f"  E-value: {hsp.expect}")
                    print(f"  Identity: {hsp.identities}/{hsp.align_length} "
                          f"({hsp.identities/hsp.align_length*100:.1f}%)")
                    print(f"  Query:   {hsp.query}")
                    print(f"  Subject: {hsp.sbjct}")

BLAST with Custom Parameters

from Bio.Blast import NCBIWWW

result_handle = NCBIWWW.qblast(
    program="blastp",
    database="nr",
    sequence=protein_seq,
    expect=0.001,          # E-value threshold
    word_size=3,           # Word size
    matrix_name="BLOSUM62", # Substitution matrix
    gapcosts="11 1",       # Gap costs (open, extend)
    hitlist_size=50,       # Number of hits
    filter="L"             # Low complexity filter
)

Batch BLAST

from Bio.Blast import NCBIWWW, NCBIXML
from Bio import SeqIO
import time

def batch_blast(fasta_file, output_file):
    """Run BLAST for multiple sequences."""
    results = []
    
    for record in SeqIO.parse(fasta_file, "fasta"):
        print(f"BLASTing {record.id}...")
        
        result_handle = NCBIWWW.qblast(
            "blastn", "nt",
            str(record.seq),
            hitlist_size=5
        )
        
        blast_record = NCBIXML.read(result_handle)
        results.append((record.id, blast_record))
        
        # Be nice to NCBI servers
        time.sleep(1)
    
    return results

# Run batch BLAST
results = batch_blast("queries.fasta", "batch_results.xml")

Protein Structure Analysis

Loading PDB Files

from Bio.PDB import PDBParser

# Create parser
parser = PDBParser(QUIET=True)

# Load structure
structure = parser.get_structure("protein", "protein.pdb")

# Access hierarchy: Structure → Model → Chain → Residue → Atom
model = structure[0]
chain = model['A']

print(f"Structure ID: {structure.id}")
print(f"Number of models: {len(structure)}")
print(f"Number of chains: {len(model)}")
print(f"Number of residues in chain A: {len(chain)}")

Extracting Information

from Bio.PDB import PDBParser

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")

# Iterate through structure
for model in structure:
    for chain in model:
        print(f"Chain {chain.id}")
        
        for residue in chain:
            # Skip hetero atoms (water, ligands)
            if residue.id[0] == ' ':
                resname = residue.resname
                resid = residue.id[1]
                
                # Get atoms
                for atom in residue:
                    atom_name = atom.name
                    coord = atom.coord
                    print(f"  {resname}{resid} {atom_name}: {coord}")

Calculating Distances

from Bio.PDB import PDBParser
import numpy as np

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")

# Get two atoms
chain = structure[0]['A']
atom1 = chain[10]['CA']  # CA atom of residue 10
atom2 = chain[20]['CA']  # CA atom of residue 20

# Calculate distance
distance = atom1 - atom2  # Overloaded operator
print(f"Distance: {distance:.2f} Å")

# Manual calculation
coord1 = atom1.coord
coord2 = atom2.coord
dist = np.linalg.norm(coord1 - coord2)
print(f"Distance (manual): {dist:.2f} Å")

Center of Mass

from Bio.PDB import PDBParser
import numpy as np

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")

def calculate_center_of_mass(entity):
    """Calculate center of mass for Structure/Model/Chain."""
    coords = []
    masses = []
    
    for atom in entity.get_atoms():
        coords.append(atom.coord)
        masses.append(atom.mass)
    
    coords = np.array(coords)
    masses = np.array(masses)
    
    com = np.average(coords, axis=0, weights=masses)
    return com

# Calculate for whole structure
com = calculate_center_of_mass(structure)
print(f"Center of mass: {com}")

Selecting Atoms

from Bio.PDB import PDBParser, Selection

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")

# Select all atoms
all_atoms = Selection.unfold_entities(structure, 'A')
print(f"Total atoms: {len(all_atoms)}")

# Select specific atoms
model = structure[0]

# All CA atoms
ca_atoms = [atom for atom in model.get_atoms() if atom.name == 'CA']
print(f"CA atoms: {len(ca_atoms)}")

# Specific residue range
chain_a = model['A']
residues_10_to_20 = [chain_a[i] for i in range(10, 21) if i in chain_a]

Secondary Structure with DSSP

from Bio.PDB import PDBParser
from Bio.PDB.DSSP import DSSP

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")
model = structure[0]

# Run DSSP (requires dssp executable)
dssp = DSSP(model, "protein.pdb")

# Extract secondary structure
for key in dssp:
    residue = dssp[key]
    chain_id = key[0]
    res_id = key[1][1]
    ss = residue[2]  # Secondary structure: H=helix, E=sheet, C=coil
    acc = residue[3]  # Accessible surface area
    
    print(f"{chain_id} {res_id}: {ss} (ASA={acc:.1f})")

Extracting Sequence from PDB

from Bio.PDB import PDBParser
from Bio.PDB.Polypeptide import PPBuilder

parser = PDBParser()
structure = parser.get_structure("protein", "protein.pdb")

# Build polypeptides
ppb = PPBuilder()

for chain in structure[0]:
    for pp in ppb.build_peptides(chain):
        sequence = pp.get_sequence()
        print(f"Chain {chain.id}: {sequence}")

Writing PDB Files

from Bio.PDB import PDBParser, PDBIO, Select

# Load structure
parser = PDBParser()
structure = parser.get_structure("protein", "input.pdb")

# Select what to save
class ChainSelect(Select):
    def accept_chain(self, chain):
        return chain.id == 'A'  # Only save chain A

# Write structure
io = PDBIO()
io.set_structure(structure)
io.save("chain_A.pdb", ChainSelect())

Phylogenetic Analysis

Building Trees from Alignment

from Bio import AlignIO, Phylo
from Bio.Phylo.TreeConstruction import DistanceCalculator, DistanceTreeConstructor

# Read alignment
alignment = AlignIO.read("alignment.fasta", "fasta")

# Calculate distance matrix
calculator = DistanceCalculator('identity')
dm = calculator.get_distance(alignment)

# Construct tree (Neighbor-Joining)
constructor = DistanceTreeConstructor(calculator, 'nj')
tree = constructor.build_tree(alignment)

# Save tree
Phylo.write(tree, "tree.xml", "phyloxml")

print(tree)

Tree Visualization

from Bio import Phylo

# Load tree
tree = Phylo.read("tree.xml", "phyloxml")

# Draw tree (ASCII)
Phylo.draw_ascii(tree)

# Draw tree (graphical - requires matplotlib)
import matplotlib.pyplot as plt
Phylo.draw(tree)
plt.savefig("tree.png")

# Interactive view
# tree.ladderize()  # Flip tree for better visualization
# Phylo.draw(tree, do_show=True)

Tree Analysis

from Bio import Phylo

tree = Phylo.read("tree.xml", "phyloxml")

# Get all terminals (leaves)
terminals = tree.get_terminals()
print(f"Number of leaves: {len(terminals)}")

# Get all non-terminals (internal nodes)
nonterminals = tree.get_nonterminals()
print(f"Number of internal nodes: {len(nonterminals)}")

# Find common ancestor
clade1 = tree.find_any(name="Species1")
clade2 = tree.find_any(name="Species2")
common = tree.common_ancestor(clade1, clade2)

# Calculate distances
dist = tree.distance(clade1, clade2)
print(f"Distance between Species1 and Species2: {dist:.4f}")

# Get path between nodes
path = tree.get_path(clade1, clade2)

Creating Trees Programmatically

from Bio.Phylo.BaseTree import Tree, Clade

# Create tree structure
tree = Tree()

# Create clades (nodes)
clade_a = Clade(branch_length=0.5, name="A")
clade_b = Clade(branch_length=0.3, name="B")
clade_c = Clade(branch_length=0.4, name="C")

# Create internal node
internal = Clade(branch_length=0.2)
internal.clades = [clade_a, clade_b]

# Create root
root = Clade()
root.clades = [internal, clade_c]

tree.root = root

# Visualize
Phylo.draw_ascii(tree)

NCBI Entrez

Searching Databases

from Bio import Entrez

# ALWAYS set your email
Entrez.email = "your.email@example.com"

# Search nucleotide database
handle = Entrez.esearch(
    db="nucleotide",
    term="Homo sapiens[Organism] AND COX1",
    retmax=10
)

record = Entrez.read(handle)
handle.close()

print(f"Found {record['Count']} records")
print(f"IDs: {record['IdList']}")

Fetching Records

from Bio import Entrez, SeqIO

Entrez.email = "your.email@example.com"

# Fetch by ID
handle = Entrez.efetch(
    db="nucleotide",
    id="NC_000001",
    rettype="gb",
    retmode="text"
)

record = SeqIO.read(handle, "genbank")
handle.close()

print(f"ID: {record.id}")
print(f"Description: {record.description}")
print(f"Length: {len(record.seq)}")

Batch Downloads

from Bio import Entrez, SeqIO

Entrez.email = "your.email@example.com"

def download_sequences(id_list, output_file):
    """Download multiple sequences by ID."""
    # Fetch records
    handle = Entrez.efetch(
        db="nucleotide",
        id=id_list,
        rettype="fasta",
        retmode="text"
    )
    
    records = SeqIO.parse(handle, "fasta")
    SeqIO.write(records, output_file, "fasta")
    handle.close()

# Download
ids = ["NM_001301717", "NM_001301718", "NM_001301719"]
download_sequences(ids, "downloaded.fasta")

Entrez with History

from Bio import Entrez

Entrez.email = "your.email@example.com"

# Search with history
search_handle = Entrez.esearch(
    db="nucleotide",
    term="human[organism] AND COX1",
    usehistory="y",
    retmax=1000
)

search_results = Entrez.read(search_handle)
search_handle.close()

webenv = search_results["WebEnv"]
query_key = search_results["QueryKey"]
count = int(search_results["Count"])

print(f"Found {count} records")

# Fetch in batches
batch_size = 100
for start in range(0, count, batch_size):
    fetch_handle = Entrez.efetch(
        db="nucleotide",
        rettype="fasta",
        retmode="text",
        retstart=start,
        retmax=batch_size,
        webenv=webenv,
        query_key=query_key
    )
    
    # Process batch
    data = fetch_handle.read()
    fetch_handle.close()

Advanced Workflows

Complete Gene Analysis Pipeline

from Bio import Entrez, SeqIO
from Bio.Seq import Seq
from Bio.SeqUtils import GC

Entrez.email = "your.email@example.com"

def analyze_gene(gene_id):
    """Complete analysis of a gene."""
    # 1. Fetch sequence
    handle = Entrez.efetch(db="nucleotide", id=gene_id, rettype="gb", retmode="text")
    record = SeqIO.read(handle, "genbank")
    handle.close()
    
    # 2. Basic stats
    length = len(record.seq)
    gc_content = GC(record.seq)
    
    # 3. Extract CDS
    cds_list = []
    for feature in record.features:
        if feature.type == "CDS":
            cds_seq = feature.extract(record.seq)
            product = feature.qualifiers.get("product", ["Unknown"])[0]
            cds_list.append((product, cds_seq))
    
    # 4. Translate CDS
    proteins = []
    for product, cds in cds_list:
        try:
            protein = cds.translate(to_stop=True)
            proteins.append((product, protein))
        except:
            proteins.append((product, None))
    
    return {
        'id': record.id,
        'length': length,
        'gc': gc_content,
        'n_cds': len(cds_list),
        'proteins': proteins
    }

# Analyze gene
result = analyze_gene("NM_000518")
print(f"Gene: {result['id']}")
print(f"Length: {result['length']} bp")
print(f"GC: {result['gc']:.2f}%")
print(f"CDS: {result['n_cds']}")

RNA-Seq Read Processing

from Bio import SeqIO
import numpy as np

def process_rnaseq_reads(fastq_file, min_quality=30, min_length=50):
    """Process RNA-seq reads with quality filtering."""
    stats = {
        'total': 0,
        'passed_quality': 0,
        'passed_length': 0,
        'final': 0
    }
    
    passed_reads = []
    
    for record in SeqIO.parse(fastq_file, "fastq"):
        stats['total'] += 1
        
        # Quality filter
        qualities = record.letter_annotations["phred_quality"]
        if np.mean(qualities) < min_quality:
            continue
        stats['passed_quality'] += 1
        
        # Length filter
        if len(record.seq) < min_length:
            continue
        stats['passed_length'] += 1
        
        # Trim adapters (simple example)
        # In reality, use specialized tools like Cutadapt
        
        passed_reads.append(record)
        stats['final'] += 1
    
    return passed_reads, stats

# Process reads
reads, stats = process_rnaseq_reads("rnaseq.fastq")
print(f"Total: {stats['total']}")
print(f"Passed quality: {stats['passed_quality']}")
print(f"Passed length: {stats['passed_length']}")
print(f"Final: {stats['final']}")

Restriction Enzyme Analysis

from Bio import SeqIO
from Bio.Restriction import *

# Load sequence
record = SeqIO.read("plasmid.gb", "genbank")
seq = record.seq

# Create restriction batch
rb = RestrictionBatch([EcoRI, BamHI, PstI, HindIII])

# Find restriction sites
analysis = rb.search(seq)

# Print results
for enzyme, sites in analysis.items():
    if sites:
        print(f"{enzyme}: {len(sites)} site(s) at {sites}")
    else:
        print(f"{enzyme}: No sites found")

# Find enzymes that cut once (good for cloning)
single_cutters = [enz for enz, sites in analysis.items() if len(sites) == 1]
print(f"\nSingle cutters: {[str(e) for e in single_cutters]}")

Codon Usage Analysis

from Bio import SeqIO
from collections import Counter

def analyze_codon_usage(genbank_file):
    """Analyze codon usage in CDS features."""
    codon_counts = Counter()
    total_codons = 0
    
    for record in SeqIO.parse(genbank_file, "genbank"):
        for feature in record.features:
            if feature.type == "CDS":
                # Extract CDS sequence
                cds = feature.extract(record.seq)
                
                # Count codons
                for i in range(0, len(cds) - 2, 3):
                    codon = str(cds[i:i+3])
                    if len(codon) == 3:
                        codon_counts[codon] += 1
                        total_codons += 1
    
    # Calculate frequencies
    codon_freq = {codon: count/total_codons 
                  for codon, count in codon_counts.items()}
    
    return codon_counts, codon_freq

# Analyze
counts, freqs = analyze_codon_usage("genome.gb")

# Print most common codons
for codon, freq in sorted(freqs.items(), key=lambda x: x[1], reverse=True)[:10]:
    print(f"{codon}: {freq:.4f}")

Performance Optimization

Memory-Efficient File Processing

from Bio import SeqIO

def process_large_fasta(filename, process_func):
    """Process large FASTA without loading into memory."""
    count = 0
    
    for record in SeqIO.parse(filename, "fasta"):
        process_func(record)
        count += 1
        
        # Progress report
        if count % 10000 == 0:
            print(f"Processed {count} sequences")
    
    return count

# Example processor
def calculate_gc(record):
    from Bio.SeqUtils import GC
    gc = GC(record.seq)
    if gc > 60:
        print(f"{record.id}: High GC ({gc:.1f}%)")

# Process
n = process_large_fasta("large_genome.fasta", calculate_gc)

Parallel Processing

from Bio import SeqIO
from multiprocessing import Pool
from functools import partial

def process_sequence(record, min_length=100):
    """Process single sequence."""
    if len(record.seq) >= min_length:
        from Bio.SeqUtils import GC
        return (record.id, len(record.seq), GC(record.seq))
    return None

def parallel_process_fasta(filename, n_processes=4):
    """Process FASTA in parallel."""
    # Load sequences
    records = list(SeqIO.parse(filename, "fasta"))
    
    # Process in parallel
    with Pool(n_processes) as pool:
        results = pool.map(process_sequence, records)
    
    # Filter None results
    return [r for r in results if r is not None]

# Process
results = parallel_process_fasta("sequences.fasta", n_processes=4)
for seq_id, length, gc in results[:10]:
    print(f"{seq_id}: {length} bp, GC={gc:.2f}%")

Index Files for Random Access

from Bio import SeqIO

# Create index (fast random access)
record_dict = SeqIO.index("large.fasta", "fasta")

# Access specific sequence instantly
record = record_dict["seq_12345"]
print(record.seq)

# Iterate (still memory efficient)
for key in record_dict:
    record = record_dict[key]
    process(record)

# Close when done
record_dict.close()

# SQLite-backed index (for very large files)
record_dict = SeqIO.index_db("large.idx", "huge.fasta", "fasta")

Common Pitfalls and Solutions

Translation Frame Errors

from Bio.Seq import Seq

dna = Seq("ATGGCCATTGTAATGGGCCGC")

# Problem: Wrong reading frame
protein = dna.translate()  # May have stop codons

# Solution: Check all frames
for i in range(3):
    frame = dna[i:]
    protein = frame.translate(to_stop=True, table=1)
    if len(protein) > 10:  # Reasonable length
        print(f"Frame {i}: {protein}")

File Format Mismatches

from Bio import SeqIO

# Problem: Wrong format specified
try:
    records = SeqIO.parse("file.fasta", "genbank")  # Wrong!
except:
    print("Format mismatch")

# Solution: Verify format
import os

def guess_format(filename):
    ext = os.path.splitext(filename)[1].lower()
    format_map = {
        '.fasta': 'fasta',
        '.fa': 'fasta',
        '.fna': 'fasta',
        '.fastq': 'fastq',
        '.fq': 'fastq',
        '.gb': 'genbank',
        '.gbk': 'genbank'
    }
    return format_map.get(ext, 'fasta')

format = guess_format("file.fasta")
records = SeqIO.parse("file.fasta", format)

NCBI Rate Limiting

from Bio import Entrez
import time

Entrez.email = "your.email@example.com"

# Problem: Too many requests
def bad_batch_download(id_list):
    for gene_id in id_list:
        handle = Entrez.efetch(db="nucleotide", id=gene_id)
        # This will get you blocked!

# Solution: Add delays
def good_batch_download(id_list):
    results = []
    for gene_id in id_list:
        handle = Entrez.efetch(db="nucleotide", id=gene_id, 
                               rettype="gb", retmode="text")
        record = SeqIO.read(handle, "genbank")
        handle.close()
        results.append(record)
        
        time.sleep(0.34)  # ~3 requests/sec
    return results

# Better: Use Entrez history for large batches

Memory Issues with Large Alignments

from Bio import AlignIO

# Problem: Loading huge alignment
alignment = AlignIO.read("huge_alignment.fasta", "fasta")  # OOM!

# Solution: Process incrementally
def process_alignment_chunks(filename, chunk_size=1000):
    records = SeqIO.parse(filename, "fasta")
    
    chunk = []
    for record in records:
        chunk.append(record)
        
        if len(chunk) >= chunk_size:
            # Process chunk
            process_chunk(chunk)
            chunk = []
    
    # Process remaining
    if chunk:
        process_chunk(chunk)

This comprehensive Biopython guide covers 50+ examples across all major bioinformatics workflows!